snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA50
sequence
aaacactgcctttgaaactcacaggtcttgggcatagcttcacagccaagcaacagtgt
agagtccaagggcttgttataagggctcttcagcactcagctgaactgctcttttaaaaa
caaggtacactt
  Box motif
  Complementary to target RNA
length 131
organism Myotis_lucifugus
snoRNA name SNORA50
alias
chromosome ⁄ contig scaffold_380
locus ⁄ host gene Mono:26:SNORA50
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U34
accession no AAPE02043617.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved