snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA3
sequence
ctctagagtcatgcttgggtattagctattgccttattgtgctagagtcctccaagagc
aactcttgaccttataaactgactgtggccctactatggaatagtcagtcaccaggctag
tgacatgc
  Box motif
  Complementary to target RNA
length 127
organism Myotis_lucifugus
snoRNA name SNORA3
alias
chromosome ⁄ contig scaffold_1
locus ⁄ host gene Mono:303:SNORA3
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3271
accession no AAPE02001332.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved