snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA67
sequence
acccaaggatcaaattcctaatatcagtttgagtaactgataccaaagtcttcatattt
ataaaacgcttcaggaaagtagcaacttggaatagaatctggcatgcctcaggttttcag
gggaggtgatacatcatttccttggccttcctttggctgcctacatgt
  Box motif
  Complementary to target RNA
length 167
organism Myotis_lucifugus
snoRNA name SNORA67
alias
chromosome ⁄ contig scaffold_489
locus ⁄ host gene Mono:412:SNORA67
organization Mono
target RNA
modification type H/ACA
modification site
accession no AAPE02047582.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved