snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA8
sequence
TGCACTGCATGGTATCTGCACTCAGCAGTTCTTTCCTGTTGGGTGTTCAAAAGACAGTG
TGATAGAAACTCACTATCTGGCATCGTTGGTTTCTTGGCTTTGTGCGTGTTAAACCTGGT
ATTTCTAATGATACAGTT
  Box motif
  Complementary to target RNA
length 137
organism Mus_musculus
snoRNA name SNORA8
alias ACA8
chromosome ⁄ contig 2
locus ⁄ host gene Eng
organization Intronic
target RNA 18S rRNA, 28S rRNA
modification type H/ACA
modification site 18S:U1057,18S:U1082,28S:U3509
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved