snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA32
sequence
TCTTGACTTCCGGATAAAATGTGACAACAATGGACGTTGCCATAAAGAAAAGTTCCCAT
TAGTTTCTCTATATGCTCCTTGCCTAGCAGTTAACCTGTTTGGAATATTG
  Box motif
  Complementary to target RNA
length 109
organism Mus_musculus
snoRNA name SNORA32
alias
chromosome ⁄ contig 2
locus ⁄ host gene Etl4
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved