snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA18
sequence
GTTGAGGTCTATCCCAGGGCTTCTCCTATAGCTGCATATTGTTAGAAACCCCTCATACA
GTTACTGGTTTTGCATCACACACAGGACTATTTCTCAGGTCTATGGGAAGGGACAAGATG
GCCAAC
  Box motif
  Complementary to target RNA
length 125
organism Mus_musculus
snoRNA name SNORA18
alias ACA18
chromosome ⁄ contig 4
locus ⁄ host gene Zmpste24
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved