snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD55
sequence
CGCGGATGATGACACCTGGGTATGCTGCACACTCCCGACTGCGTCGTGGGGAAGCCAAC
CTTGGAGAGCTGAGCGTGCG
  Box motif
  Complementary to target RNA
length 79
organism Mus_musculus
snoRNA name SNORD55
alias
chromosome ⁄ contig 4
locus ⁄ host gene Rps8
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:C2557
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved