snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA36
sequence
TCCCAAAGTGTTGAGTTCAGTTCAGGGCAGCTTCCCTGTTCTGTTAATTAAACTTTGGG
ACATTGGAATTGGCTGAGGGAAATGACTGAATAGAGAGCATTACTCTATTCATATTCTTC
TAGCCTACACAA
  Box motif
  Complementary to target RNA
length 131
organism Mus_musculus
snoRNA name SNORA36
alias ACA36
chromosome ⁄ contig 4
locus ⁄ host gene Nans
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1244,18S:U105
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved