snOPY snoRNA Orthological Gene Database
Mus_musculus snR38-1
sequence
TTGAGCTGAGGATGATTTAAGTTATCCCTGTCTGAAATGACACTTTTGTGAAGAGTCAT
GGTTTACTGAGGCTCGA
  Box motif
  Complementary to target RNA
length 76
organism Mus_musculus
snoRNA name snR38-1
alias
chromosome ⁄ contig 11
locus ⁄ host gene 1810032O08Rik
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G4044
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved