snOPY snoRNA Orthological Gene Database
Mus_musculus snoZ17
sequence
GGTGCATGTGATGACATTATTTAGCGACCAAAGTCTGATAAAGATGATTGTGATCTATT
GTCTGATGCACC
  Box motif
  Complementary to target RNA
length 71
organism Mus_musculus
snoRNA name snoZ17
alias
chromosome ⁄ contig 11
locus ⁄ host gene Rpl23a
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:U121
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved