snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA67
sequence
GTCCAAGGTGATTCCCTCTCCAAAGGGCTGACTGTGTGCCCTTTTCAGGAACGTAGCAA
CTTGGAAGAAAACCAGGCGTGCCTGAGGTCTCTGGTGGACAAGAAACTCTTGTTTCCTTT
GCCCTCCTCTGGCTGCCTACATGT
  Box motif
  Complementary to target RNA
length 143
organism Mus_musculus
snoRNA name SNORA67
alias U67
chromosome ⁄ contig 11
locus ⁄ host gene Eif4a1
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1445
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved