snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD96
sequence
GATCCTAGTGATGACAAGACGACATTGTCAACCAATCCCCCACAAGGGAATGAGGACAT
GTCCTGCAATTCTGAATGGGTT
  Box motif
  Complementary to target RNA
length 81
organism Mus_musculus
snoRNA name SNORD96
alias
chromosome ⁄ contig 11
locus ⁄ host gene Gnb2l1
organization Intronic
target RNA 5.8S rRNA
modification type C/D
modification site 5.8S:G77
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved