snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA28
sequence
AAGCAACACTCTGTGGCAGATGAACAAAACCGTCTGACACAATTTGAGCTTGCTATAGC
AAGAAAGTCTAACCTATTCCGGTGTTCTCTTTCCCCATGAGACAAGCCGTTATATAGGCT
CTAACAAA
  Box motif
  Complementary to target RNA
length 127
organism Mus_musculus
snoRNA name SNORA28
alias ACA28
chromosome ⁄ contig 12
locus ⁄ host gene Eif5
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U816,18S:U867
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved