snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD92
sequence
TGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCGACTCACTGAGAGTAACGTGAGGAC
CTACAGTTCCTTGGCTGTGTCTGAGCACC
  Box motif
  Complementary to target RNA
length 88
organism Mus_musculus
snoRNA name SNORD92
alias
chromosome ⁄ contig 17
locus ⁄ host gene Wdr43
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A3523
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved