snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA38
sequence
TCCTCCTACAAAGGCGTGTTTTTGGTTCCCTGTCCTTGGACACGTAAGAATCGGAGGCA
AAGTAATGTGGTGGATTTGAAAAGGTCTTGGACCAGCTTGCCCCCCGCAGGCTCAGGATC
AACCATCCCACAGAT
  Box motif
  Complementary to target RNA
length 134
organism Mus_musculus
snoRNA name SNORA38
alias ACA38
chromosome ⁄ contig 17
locus ⁄ host gene Bat2
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved