snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA20
sequence
TTTCCCATTAATTTGCTGCTCTAGTCTGTCAGTGATAGGAGCGGTTATACGCATGGGAT
AAAACAATATTGGGCCATTGTACATGGAGATGAAATGTGTTTTGTCTCTCGTACATGGTC
TAGACATTG
  Box motif
  Complementary to target RNA
length 128
organism Mus_musculus
snoRNA name SNORA20
alias ACA20
chromosome ⁄ contig 17
locus ⁄ host gene Tcp1
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U652
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved