snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA29
sequence
TTTCCCATTTGACTACCACATTTTTCTCCTAATAGAGTTTAGTGGCTATGCTTATGGGA
TAGATGAAAGGTGCCATGATCTGAAGAGGGGGAGCTGTCCTGTGTCTTTCCTCTATATGA
AATGGCTGAACAGAAACCA
  Box motif
  Complementary to target RNA
length 138
organism Mus_musculus
snoRNA name SNORA29
alias ACA29
chromosome ⁄ contig 17
locus ⁄ host gene Tcp1
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved