snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD45
sequence
GGTCAATGATGTGTTGGCATGTATTATCTGAATTCGCTGATGTGTCATAACACTTTAGC
TCTAGAATTACGCTGAGACCTT
  Box motif
  Complementary to target RNA
length 81
organism Mus_musculus
snoRNA name SNORD45
alias
chromosome ⁄ contig 3
locus ⁄ host gene Rabggtb
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A159,18S:U172
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved