snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD73
sequence
AACATGTGATGAGAAACTGTTTCGGTCCCAGTTGATGGCCACTGATAACATTACATTTT
TCTGATGTT
  Box motif
  Complementary to target RNA
length 68
organism Mus_musculus
snoRNA name SNORD73
alias
chromosome ⁄ contig 3
locus ⁄ host gene Rps3a
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G1562
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved