snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA69
sequence
AAAGCAGGTTACAAGTATAGCTCTTCATTTTGTGGAATTACTGCTCTTTACTACCCTGC
TAAAGAGCAGCCATGTTGATGCCTCTGATTTTACCTTTATGAAAGTAAAAATAACAGCCT
GACAAAGACAGTC
  Box motif
  Complementary to target RNA
length 132
organism Mus_musculus
snoRNA name SNORA69
alias U69
chromosome ⁄ contig 3
locus ⁄ host gene Nbea
organization Intronic
target RNA 5.8S rRNA
modification type H/ACA
modification site 5.8S:U71
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved