snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA62
sequence
CCTGCACATTGTTAGAGCTTGGAGTTGAGGTCACACGCTGGTCGATGAACTCACAAGTG
TAGGTAGTGTGCTAAAAGAGTGGCAAGGTTTTCGCTAACACCCCACTCTGGTCCAGTGAG
TGGGGTTTGATAGTAACCTTTGCTACAAAA
  Box motif
  Complementary to target RNA
length 149
organism Mus_musculus
snoRNA name SNORA62
alias E2
chromosome ⁄ contig 9
locus ⁄ host gene Rpsa
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28SU:3507,28S:U3509
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved