snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA61
sequence
ACCTCTGCTTCCCCTTCCCATAGACAGCGCTGCCGGTCACGATGGTGACAAAGACTGAA
GAGTACACCAAAGCTGGCCTCACAGCTGTATGGTCCGGTAGAAAGCATGTGGGCCAGATC
CAAATAGGC
  Box motif
  Complementary to target RNA
length 128
organism Mus_musculus
snoRNA name SNORA61
alias
chromosome ⁄ contig 9
locus ⁄ host gene D330022A01Rik
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved