snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD18
sequence
TGGTTATGATGAAATTCCACTTCATGGTCCGTGTTTCTGAAATAACATGATATTGTGGA
AGTTCTGAGTCC
  Box motif
  Complementary to target RNA
length 71
organism Mus_musculus
snoRNA name SNORD18
alias
chromosome ⁄ contig 9
locus ⁄ host gene Rpl4
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A1140
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved