snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD105
sequence
CTCCTGTCTGATGATGAGCCCATTGCCCTGAGCTCTTGTGATGCTGGCTTCAAAGTAAA
CGCTCTGAAGTGAAGGAGCAGGGC
  Box motif
  Complementary to target RNA
length 83
organism Mus_musculus
snoRNA name SNORD105
alias
chromosome ⁄ contig 9
locus ⁄ host gene Ppan
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:U800
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved