snOPY snoRNA Orthological Gene Database
Mus_musculus snoU2-30
sequence
TCTCTGAGATCTACTGAAATAGATCAGTGATGAAAATAGCCAAATCTGAGCATCAGAAG
GCCTTTTGGTCTGGGGCATGATCTCTCTAGTTCTGAGAAGCAAAACTACAAAGCGGTTTG
TCTGTGGTGAGAGAAGGAAGAGTGGTGTATGGATGGATGGATGAGGGTGTGTACATATCT
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGGTCATCTCTGAGCAATGATGA
AAAGGTTTTAGTACTGAATTTTGTCACTGTGAAGGCTCCTACACTTGACCTGAGCTCA
  Box motif
  Complementary to target RNA
length 297
organism Mus_musculus
snoRNA name snoU2-30
alias
chromosome ⁄ contig 9
locus ⁄ host gene 5830418K08Rik
organization Intronic
target RNA Unknown
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved