snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA79
sequence
TGATGACTGTTCCTCCTATTGCCTTTAGATATGGCACTAGGATTTTAGGTCATCATAAA
TTAAAATTGATTTTTTTTCACTCAGAGAATATTAAGATACTGGGATTATCTATGTATTCT
CTGAAATTTGCGGGATCAAACAGTT
  Box motif
  Complementary to target RNA
length 144
organism Mus_musculus
snoRNA name SNORA79
alias ACA65
chromosome ⁄ contig 16
locus ⁄ host gene Fbxo45
organization Intronic
target RNA U6 snRNA
modification type H/ACA
modification site U6:U31,U6:U86
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved