snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA77
sequence
GCAGATTCACTCTGCACCTGGCTGCAGCTCCAGTCTGGTGCTTTTTCCATCTGCCAAAG
AAACAGTCCAGAATGCTGTGGCTTCCTCTGCCTATCAGAGGCAGTGCAGCTGCCTGGGGA
CACAGCC
  Box motif
  Complementary to target RNA
length 126
organism Mus_musculus
snoRNA name SNORA77
alias ACA63
chromosome ⁄ contig 16
locus ⁄ host gene Ranbp1
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U815
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved