snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA2
sequence
ATGGCTCTTACTGAAGACTAGCAGTTATACACTGTAGCTGTTGGTTTCAAGCAGACGCC
TAGAGAACTGTCTTCCAGTGGTTTATTAGCTACTCTGGACTTCAGTAGAGAATGACTATT
TCATTTGGAAGAAACAACC
  Box motif
  Complementary to target RNA
length 138
organism Mus_musculus
snoRNA name SNORA2
alias ACA2a
chromosome ⁄ contig 15
locus ⁄ host gene 2310037I24Rik
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3945,28S:U3964
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved