snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA11
sequence
GGGGTGTGCTCAGAGCAGGTGGCCTGAAGAATGGCTTCTCTGTTTACAACACACCCAAG
AAGAATCTGGGACCATTGTAATGAGGGGCACAAGCAGTTCCCTCTCTGTGAATGGATCCC
CTACATGT
  Box motif
  Complementary to target RNA
length 127
organism Mus_musculus
snoRNA name SNORA11
alias U107
chromosome ⁄ contig 15
locus ⁄ host gene 2410187C16Rik
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved