snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA72
sequence
CTGCGAATATTCTCGCTGTTCTGATTCTGTGATAATCAGGACAGGCTAGACATTCGCTA
TAGTAAGACCATGCATGTGTCCCCAGACCTAGTTCTTTACTTCAGTCTGGTTATCTAAAT
GCTGGTGACAGAC
  Box motif
  Complementary to target RNA
length 132
organism Mus_musculus
snoRNA name SNORA72
alias U72
chromosome ⁄ contig 15
locus ⁄ host gene Rpl30
organization Intronic
target RNA 5.8S rRNA
modification type H/ACA
modification site 5.8S:U57
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved