snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA53
sequence
AACATGCTTCCTTAGATCCACCTTTGTGGATGGGTCTTGGACTGAGTTCTACCTGTAAA
CTTCTTGTTTCTTGTGGTTCCAGTCCAAGAAACGTCCAGCAACTTTGTTGGTTGTATAGT
CGAAGGTGCTTGAGTCATTGGCATGTGAGACTAATATACCTGCATGCTAGTCTTCAGGTT
CTGATGGAAGTGACATGCGTGATGCTGTCATGTGTTACTGTCAGGACTCGACTGGTGTGC
GGACACG
  Box motif
  Complementary to target RNA
length 246
organism Mus_musculus
snoRNA name SNORA53
alias ACA53
chromosome ⁄ contig 10
locus ⁄ host gene Slc25a3
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved