snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD37
sequence
CACCATGATGACGGAAATTCTTCACTTTGACCTGATGTCTGTTGAAGAAACTCAGTGTC
TGAGA
  Box motif
  Complementary to target RNA
length 64
organism Mus_musculus
snoRNA name SNORD37
alias
chromosome ⁄ contig 10
locus ⁄ host gene Eef2
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A3374
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved