snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD98
sequence
GAGTTATGATGTGTAAATCCTATTCCATTGCTGAAATGCAGTGTGGAACATAATGAACT
GAACTC
  Box motif
  Complementary to target RNA
length 65
organism Mus_musculus
snoRNA name SNORD98
alias
chromosome ⁄ contig 10
locus ⁄ host gene Ccar1
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:G868
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved