snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD100
sequence
GCTGTACATGATGAAAACAGTCTCCCTCTTCTGAATCTCGCTGAGGAAACTGCACGTCA
CCCTCCTGAAACAGC
  Box motif
  Complementary to target RNA
length 74
organism Mus_musculus
snoRNA name SNORD100
alias
chromosome ⁄ contig 10
locus ⁄ host gene Rps12
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:G437
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved