snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA35
sequence
CAGCACTGGCAAGTGACCCATTGGACTTTTTCTTGACCAACTGGGCATCGAGCAGTGCG
AAAACAAAACCCTCCGAAAGATGGGAGAGTCACACTGTGGGCTACTCCCGCATGCAGGTG
GGTACATAG
  Box motif
  Complementary to target RNA
length 128
organism Mus_musculus
snoRNA name SNORA35
alias HBI-36
chromosome ⁄ contig X
locus ⁄ host gene Htr2c
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved