snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD61
sequence
GCTGTGATGAATTTGAATCCACTGATCTTCCGACATGATAAATGCATTGTCCTCTAAGA
AGTTCTGAGCTT
  Box motif
  Complementary to target RNA
length 71
organism Mus_musculus
snoRNA name SNORD61
alias
chromosome ⁄ contig X
locus ⁄ host gene Rbmx
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:U1442
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved