snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA5
sequence
TGCAGTCGAGTCAAATTCAGCTTCCATTCTTTCATGGTGGGAGCTGGCCCGGATGGCTG
CCACAGCAAGCTCTGCTGCTCATGGGCCCTGCTCTCTGTATTGGGACCCAGGGATAAGGT
TGGCTGCAGACAAAA
  Box motif
  Complementary to target RNA
length 134
organism Mus_musculus
snoRNA name SNORA5
alias ACA5
chromosome ⁄ contig 14
locus ⁄ host gene Gtf2f2
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1238,18S:U1625
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved