snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA26
sequence
GTGCCCTTTCTAGGCTAACACAGTCCTGTAAGAGGCTAGCACAGAGGGGTAGAGGAAAT
CTCTATTAACTCAGAAAAGGCACTGCAAACCTCCTCTTGAAGCCTTTTTGAAGCCACAGC
T
  Box motif
  Complementary to target RNA
length 120
organism Mus_musculus
snoRNA name SNORA26
alias HBI-6
chromosome ⁄ contig 14
locus ⁄ host gene Cryl1
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4204
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved