snOPY snoRNA Orthological Gene Database
Mus_musculus snoU6-53
sequence
TCCCGATGATGAGCTGCCATGCTAATACTGAGTCACCAGGCAGGGCAGTATTGTCCTGG
TTTGGGTGCCAGTGAGTTTAACAAAACTTCTCATGTGGAGACCTGAGGGAC
  Box motif
  Complementary to target RNA
length 110
organism Mus_musculus
snoRNA name snoU6-53
alias
chromosome ⁄ contig 14
locus ⁄ host gene Chd8
organization Intronic
target RNA U6 snRNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved