snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA74
sequence
CCCAGTAGTAGTCAGCCATCCCAGACACATTCCTGTGATGGTGTTACACTGCTGGGAGA
GTAATGTGTGCTCTTCACCTGGTTGCTGGGTCACCGTTCTGGTGGGCTGTGACTCTGGTG
TAAGACCAAACTTTGCTTCCTTGAGAGTGTGCTAAGCATTCGCTTTGACTGCTTAGTTCT
AGTATGGGAGCAGACAGT
  Box motif
  Complementary to target RNA
length 197
organism Mus_musculus
snoRNA name SNORA74
alias U19-2
chromosome ⁄ contig 14
locus ⁄ host gene Timm23
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3418,28S:U3420
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved