snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD69
sequence
AACATGAAGCAGTGATGACAGATTGGATCTGACTTAACTGCTGTGCTGAGTTTGTTCAA
TCCAACCCTGAGCTTCATGTT
  Box motif
  Complementary to target RNA
length 80
organism Mus_musculus
snoRNA name SNORD69
alias
chromosome ⁄ contig 14
locus ⁄ host gene Gnl3
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G4146
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved