snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA14
sequence
TTGCATTCTTAAACCCTCTTGGCAGCTTTGCTCTGGTGCTTCCAAGATATGAGTGAATG
CTAGACAAAGTGCGGGGGAGTCCAAAGGGCTGCGCTCCTCACGTGGCTCAGTCTTATTTC
ATACCTGCGACATCT
  Box motif
  Complementary to target RNA
length 134
organism Mus_musculus
snoRNA name SNORA14
alias ACA14b
chromosome ⁄ contig 8
locus ⁄ host gene Tomm20
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U967
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved