snOPY snoRNA Orthological Gene Database
Mus_musculus snoMBII-202
sequence
TGATGACATTCTCCGGAATCGCTGTACTGACTTGATGAAAGTACTTTTGAACCCTTTTC
CATCTGATGACACCGAGTTTTCTC
  Box motif
  Complementary to target RNA
length 83
organism Mus_musculus
snoRNA name snoMBII-202
alias
chromosome ⁄ contig 8
locus ⁄ host gene Rpl13
organization Intronic
target RNA 18S rRNA, 28S rRNA
modification type C/D
modification site 18S:U429,28S:A2256
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved