snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD111
sequence
CAGCCTGAAGTGATGATTCACAATCATGTCTCTTCTCTGAAGAATTCATGGAGATTCTG
TGTATCTGATCAGGCCT
  Box motif
  Complementary to target RNA
length 76
organism Mus_musculus
snoRNA name SNORD111
alias
chromosome ⁄ contig 8
locus ⁄ host gene Sf3b3
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G3600
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved