snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD71
sequence
CGTGTGCTGGAGGATGAAGTAAGGAGTGATCCATCGGCTAAGTGTTTTCCCACTGTGCT
GACACTCACATTGCTGACAGTGCACG
  Box motif
  Complementary to target RNA
length 85
organism Mus_musculus
snoRNA name SNORD71
alias
chromosome ⁄ contig 8
locus ⁄ host gene Ap1g1
organization Intronic
target RNA 5.8S rRNA
modification type C/D
modification site 5.8S:U14
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved