snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA42
sequence
GCATAGATTTGGACTATGGCAGGCTCCTCCCCATGGGCTTCTCATAGTGTCTCATGCTA
GAGCAAACTGTTGCTCCTAACCATTGTCCAGCCTCAGTCCCTGTAGGCTGCTGGCCCTGA
AGTGGGTCACACAGTA
  Box motif
  Complementary to target RNA
length 135
organism Mus_musculus
snoRNA name SNORA42
alias ACA42
chromosome ⁄ contig 8
locus ⁄ host gene March1
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U573,18S:U109
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved