snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA12
sequence
TTGGGTGGTAGTGTCTTCCTGGCGCATTTGTTAAGTGTTCAAATGGGCCCGACTCTGCC
ACATACATTATGCAGGAGCTGGCAAAGGCTTAGAGACAAAGAAGTCTCTCTTGAGTGTTT
CCTAATAACAGATTGGCTCCCATATGT
  Box motif
  Complementary to target RNA
length 146
organism Mus_musculus
snoRNA name SNORA12
alias U108
chromosome ⁄ contig 19
locus ⁄ host gene Cwf19l1
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved