snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA17
sequence
CCTGCCTCTAGAGGTGTCACGGGTGTGACTGATGTGTCTTCTGTGAGTCAGTAGGTGGC
ACAGAAGAGAGAGGCTGTGTCTATGCTCAATGTGTTCTGACCTGTGAATACCTGATAGCT
TAGTTGCCTAACATT
  Box motif
  Complementary to target RNA
length 134
organism Mus_musculus
snoRNA name SNORA17
alias
chromosome ⁄ contig 1
locus ⁄ host gene 4921528O07Rik
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved