snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD75
sequence
AGCCCATGATGGTATGAGAGTAGTGGACAGAAGGGATTTCTGAAAAACACTTTTCTGAG
GCT
  Box motif
  Complementary to target RNA
length 62
organism Mus_musculus
snoRNA name SNORD75
alias
chromosome ⁄ contig 1
locus ⁄ host gene Gas5
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:C3704
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved