snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD74
sequence
GTGTTCATGCTATGATGAAGGCTATGTTGGTAGGGACAACTGAGCTTGTTGATGAATAC
CAACGATTCTGATGGCAGAGC
  Box motif
  Complementary to target RNA
length 80
organism Mus_musculus
snoRNA name SNORD74
alias
chromosome ⁄ contig 1
locus ⁄ host gene Gas5
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:C3497
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved